Question: Question 23 (1 Point) Proteins Are Made At The Nucleus Cytoplasm Question 24 (1 Point) MRNA Is Made During Transcription Translation
can i know these two no explantion please
Transcribed Image Text from this Question
Question 23 (1 point) Proteins are made at the nucleus cytoplasm Question 24 (1 point) mRNA is made during transcription translation
Is this your assignment or some part of it?
We can do it for you! Click to Order!
Related posts:
- Question: 62. Differentiate Between The Three Types Of RNA Involved In Translation: Exists Inside A Cellular Structure That Is Built ✓ [Choose In The Nucleolus TRNA TRNA Built And Processed In The Nucleus MRNA ITU Sticks To One Unique Amino Acid In The Cytoplasm. [Choose Carries The CODON [Choose May Exist As A Free Molecule In The Cytoplasm. [Choose < Carries ...
- Question: The 3′ Poly-A Tail Added During MRNA Processing 8 1) Protects The MRNA From Degradation 2) Facilitates MRNA’s Export From The Nucleus 3) Is Involved In Initiation Of Translation 13 4) 1 And 2 5 5) 1, 2, And 3
- Question: Protein Synthesis Summary: DNA MRNA— Ribosome Protein Nucleus Nuclear Membrane 7 Hoo B 8.9 3 33 5-6 4 5. Identify Molecule At The End Of Pointer. 6. Function Of # 7. Identify Monomer At The End Of Pointer. 8. Identify Organelle 9. Function Of #8 10. What Letter Represents Transcription? 11. What Letter Represents Translation?
- Question: As The Principal Investigator Of A Team Of Scientists, You Are Determined To Create A Method By Which Individuals Could Died Surgically Alter Their Hypothalamus To Control Their Weight. Which Hypothalamic Nucleus Would Cause Starvation Etwas Credo Destroyed? Answers A Lateral Nucleus B Paraventricular Nucleus C Mammiltary Body D Posterior Nucleus E …
- Question: Below Is The Sequence Of A DNA Double Helix. Reading The Top Strand, Transcribe A Messenger RNA (mRNA) Molecule. AGGCTACGGTGCCCAGTAGAGCCTGCACTCTTAGCT MRNA: : TCCGATGCCACGGGTCATCTCGGACGTGTGAATCGA 3. Your MRNA Will Now Be Translated. Refer To The Genetic Code On Page 2 A. Copy Your MRNA Strand Below For Convenience. B. Find And Underline The First AUG …
- Question: Question 6 (1 Point) If You Had An E.coli With A Mutant Form Of EF-Tu That Hydrolyzed GTP More Rapidly Than The Wild-type EF-Tu Which Of The Following Would You Expect? Slower Translational Initiation Faster Translation Initiation Slower Translation Elongation With More Mistakes More Premature Translational Termination Faster Translation Elongation …
- Question: Question 27 Of 30 1.0 Points Below Is An Electron Micrograph Illustrating The Process Of Simultaneous Transcription And Translation In A Prokaryotic Cell. Use This Illustration To Answer The Question Below. B A Which Of The Following Statements Is Correct? 1. If B And C Are Both Pointing To Ribosomes At The 5′ End Of The MRNA, Then B Is Carrying A Much …
- Question: Transcribe And Translate The Following Gene Fragments. Make Sure To Pay Attention To The Orientation. Which Direction Must Transcription/ Translation Occur. If You Do Not Pay Attention To Orientation, Your Answers Will Be Incorrect. 1. Label All 5’ And 3’ Ends Of The Molecules (DNA, MRNA, And TRNA) As Well As The N Terminus And C Terminus Of The …
- Question: Question 47 Homework – Unanswered Which Of The Following Is True Regarding The Machinery Of Translation In Eukaryotes? Select An Answer And Submit. For Keyboard Navigation, Use The Up/down Arrow Keys To Select An Answer A A Single MRNA Can Be Translated Simultaneously By Several Ribosomes. B Polycistronic MRNA Usually Has A Single Ribosome Binding …
- Question: Question 10 2 Pts Choose The False Statement: Only One Ribosome At A Time Can Bind To Each MRNA Transcript; Only When Each Protein Is Completed Can A Second Round Of Translation Occur Along The Same Piece Of MRNA. [ Select Once A TRNA Binds To Its Codon And Gives Up Its Amino Acid It Will Be Recycled, I.e., Released By The Ribosome And Eventually Recharged …
